JP

Acceleration in the field of translational research and regenerative medicine

The application of genome editing technology has facilitated the generation of human disease models not only in mice but also in a variety of other animal species. Among these, rats have attracted increasing attention due to their unique physiological characteristics and the growing body of research demonstrating their advantages in biomedical applications.

To note, rats generally possess a genomic background and anatomical features more similar to those of humans compared to mice. More importantly, larger body size in rats allows for harvesting ample biological samples, enabling a wide range of detailed downstream applications. In parallel, rats have long been used in pharmacological efficacy and toxicity assays, suggesting a substantial and robust dataset for the cross-reference. All these factors again underline immunodeficient rats as a valuable bioresource in advancing cancer, stem cell, transplantation research, and drug development, which positions them as one of the most widely used animal models in medical and life sciences studies.

Available Strains

We are currently providing three immunodeficient rat strains. These rats are bred in clean and dedicated facilities to ensure that they are safe and suitable for experimental use. If you have any questions regarding breeding methods or facility requirements, please feel free to contact us.

NBRP Rat No.StrainCharactersGenotyping*
0883F344-Il2rgem1IexasA rat with a 5 bp deletion in the Il2rg gene on the X chromosome, resulting in severe combined immunodeficiency (SCID). The rat develops about as normally under SPF (Specific Pathogen-Free) conditions.(Target) Il2rg PCR (Product Size) Wild Type : 292 bp, Mutant : 287 bp, (Primers) F: TTGCTGACTTCTATGGACCTTAAA, R: TTCATCTGGTCTGAACTGATAACTTAT
0894F344-Rag2em1IexasA rat with a 1 bp insertion in the Rag2 gene on chromosome 3, exhibiting a phenotype similar to severe combined immunodeficiency (SCID). The rat develops about as normally under SPF (Specific Pathogen-Free) conditions.(Target) Rag2 PCR (Product Size) Wilde type : 381bp, Mutant : 382bp, (Primers) F: GGGGAGAAGGTGTCTTACGG, R: AGGTGGGAGGTAGCAGGAAT
0895F344-Il2rg/Rag2em1IexasA rat with a 5 bp deletion in the Il2rg gene and a 1 bp insertion in the Rag2 gene, resulting in severe combined immunodeficiency (SCID). It develops almost normally under SPF conditions, yet sexual maturation is slightly delayed.Can be identified from the combined assay method of NBRP Rat No.0883 and 0894.

Achievements

The fourth phase of NBRP-Rat began in April 2017, and the rat strain provision service has been recorded since then from Osaka University. The record and provision service continues even after the transfer to the University of Tokyo in April 2020.

Fiscal YearsNumber of CasesNumber of provided institutesNumber of provided rats
20246014302
20234913304
20224511291
2021221191
2020207107
201915660
201815654
20171114

Application Examples

List of Publications

Rat polyomavirus 2 infection: secondary publication. *NEW*
Tanaka M.
Exp Anim. 2026 Jan 1;75(1):1-9. doi: 10.1538/expanim.25-0072. Epub 2025 Sep 3. PMID: 40903308.

In vivo regeneration of rat laryngeal cartilage with mesenchymal stem cells derived from human induced pluripotent stem cells via neural crest cells.
Yoshimatsu M, Ohnishi H, Zhao C, Hayashi Y, Kuwata F, Kaba S, Okuyama H, Kawai Y, Hiwatashi N, Kishimoto Y, Sakamoto T, Ikeya M, Omori K.
Stem Cell Res. 2021 Apr;52:102233. doi: 10.1016/j.scr.2021.102233. Epub 2021 Feb 11.